miércoles, 12 de septiembre de 2007

Pruebas de ADN

Reproduzco a continuacion mi aportacion al blog de Elvira:

Es sorprendente, a veces, las aparentes contradicciones que se pueden hallar en los medios de comunicacion. Asi, mientras algunos periodicos insisten en la noticia de que las muestras de ADN son 100% de Maddie, otros destacan el hecho de que la policia afirma que de los resultados no se puede concluir de manera absoluta "que pertenezcan a la persona A o a la persona B", como he leido por ahi.

Si me lo permites, voy a utilizar tu blog para hacer un poco de divulgacion cientifica (el mio no lo lee ni dios) y explicar por que no hay tal contradiccion.El material genetico de las personas (de la misma manera que el de las plantas y otros animales) esta compuesto de ADN. El ADN es una sustancia quimica con propiedades peculiares. Su estructura es la de una cadena lineal formada por cuatro tipos de "eslabones". Los "eslabones", por su parte, son 4 sustancias quimicas que se suelen representar por las letras A, T, C y G.

Por ejemplo, una cadena de ADN podria ser:

ATCTGATTCGGGATGGCGGATTATAGGCCCGGTATAGGCTTACG


En una parte muy importante de nuestro genoma, las letras de esta cadena no se ordenan al azar. Del mismo modo que las letras del alfabeto nos sirven para formar palabras y oraciones, las 4 letras del ADN contienen informacion sobre como construir proteinas. Por ello, el "texto" apenas varia de unos individuos a otros.Podria decirse que otras partes de genoma (las que no contienen instrucciones para fabricar proteinas) no son tan importantes y, por ello, no son iguales en todos los individuos.

1) Que hacen los forenses?
Los forenses utilizan los restos biologicos (sangre, pelos, etc) para extraer ADN. A continuacion, podria decirse que "leen" el contenido de unas cuantos fragmentos del genoma. Estos fragmentos no se eligen al azar, sino que se eligen porque SE SABE QUE EXISTE GRAN VARIABILIDAD ENTRE LOS INDIVIDUOS. Cada uno de estos fragmentos se denomina, tecnicamente, "marcador". Se ha dicho en la prensa que las pruebas de ADN de Madeleine se han hecho con 20 marcadores.

2) Que leen los forenses en CADA marcador?
Tengo que aclarar aqui que nuestro genoma consta de 46 cadenas de ADN (tambien llamadas "cromosomas"). Estas 46 cadenas se clasifican en 23 tipos distintos, por lo que lo que tenemos son 23 "pares de cromosomas".
Casi todo el mundo ha oido hablar de los cromosomas. Por ejemplo, uno de los pares es el formado por los cromosomas X e Y, cuyas combinaciones determinan el sexo de los individuos. El sindrome de Down se produce cuando el individuo tiene un trio (en lugar de un par) de cromosomas del par numero 21.
Los cromosomas se agrupan en pares porque, de cada pareja, recibimos uno de nuestro padre y otro de nuestra madre. Y que tiene esto que ver con lo que leen los forenses? Cuando los forenses estudian un marcador concreto, el resultado (la "lectura") son dos textos: uno heredado de la madre y otro heredado del padre.

3) Un ejemplo:
Imaginemos por un momento que para un marcador ( como los estudiados por los forenses) existen distintas variantes. Llamare a estas variantes mediante numeros: "1", "2", "3", "4", etc.

La madre ha de tener dos de ellas y el padre otras dos. Digamos que la madre es 1-1 y el padre es 2-4. Entonces los hijos solo pueden ser 1-2 o 1-4.

Imaginemos que en una prueba de paternidad se encuentra que el hijo es 1-3. Conclusion: esta claro que hay infidelidad.

Imaginemos ahora que se hace la prueba a otro hijo, y que este es 1-4. Para este hijo, a priori, no hay problema.

Observad que en el primer caso, que es un ejemplo de EXCLUSION de la PATERNIDAD, no hay lugar a duda. El "3" no puede venir del padre, luego el padre ha de ser otro hombre. Pero OJO: en el segundo caso, que es un ejemplo de ASIGNACION POSITIVA de la paternidad, aunque hay coincidencia entre las "lecturas" del hijo y sus presuntos padres, aun existe la posibilidad de que el padre sea otro hombre (por ejemplo que el hijo hubiera recibido el "4" de un tio paterno)

4) Y entonces que?
Cuando los forenses miran a los 20 marcadores del ADN de Madeleine, obtienen 40 datos agrupados en pares:
marcador 1: 1-3
marcador 2: 11-27
marcador 3: 2-5
etc.

Y comparan esta "quiniela" con la de cada uno de sus padres. La mitad de los numeros de Madeleine provienen de su padre y la otra mitad de su madre.

5) Cosas que se han dicho y una posible explicacion cientifica:

- "A lo mejor el ADN proviene de los padres".
IMPOSIBLE: Aunque el ADN de los hijos proviene del de los padres, pueden distinguirse perfectamente. Por ejemplo, los hijos tienen material genetico procedente de la madre que no se encuentra en el padre. Los padres, por su parte, tienen material genetico que NO transmiten a sus hijos (recuerdese que cada progenitor solo transmite 1 cromosoma de cada par). La contaminacion de una muestra con de ADN del padre y de la madre no puede, NUNCA, confundirse con el ADN de los hijos.

- "A lo mejor el ADN es de los hermanos":
IMPOSIBLE: En el primero de mis ejemplos, para un solo marcador, los hijos podian ser 1-2 o 1-4. En este ejemplo la probabilidad de ser 1-2 es del 50% y la de ser 1-4 es del 50%. Exactamente como tirar una moneda al aire. Para que lo entendais: Si se estudian 20 marcadores, la probabilidad de que dos hermanos tengan la misma combinacion es bajiiiiisima. Como tirar 20 monedas al aire en dos series y que salga el mismo resultado en ambas.

-"No se puede decir, al 100%, que el ADN es de la persona tal".
CORRECTO. Como en el ejemplo de "asignacion positiva de la paternidad", siempre cabe la posibilidad de que exista otra persona con la misma combinacion. SIN EMBARGO, para resolver este problema los cientificos asocian el resultado con un valor de probabilidad. Se ha dicho que la probabilidad de que una persona cualquiera tenga la misma "quiniela" que Madeleine es de 1 en mil millones (1 billon de los britanicos). Es decir 1 persona de cada 1000.000.000 tendria por azar la misma "quiniela que Maddie.

- "Las muestras han dado un resultado PARCIAL, coincidente en un 80% con el ADN de Maddie".
Como las muestras estan degradadas (por el tiempo, la humedad, etc.) es posible que los forenses solo hayan podido "leer" parte de los marcadores. Ese 80% podria deberse a que solo han podido leerse 16 de los 20 marcadores. Si los 16 marcadores leidos coinciden plenamente con el ADN de Madeleine, eso modificara unicamente la probabilidad de que una persona al azar tenga la misma quiniela. Esa probabilidad seria un poco mayor, quiza 1 en 10.000.000 (diez millones), pero aun bastante interesante, no?

Bueno, espero que mis comentarios te resulten de interes a ti y al publico, y enhorabuena por el blog

4 comentarios:

Alfonso Armenta dijo...

Muy buena la aportación al blog de Elvira. Gracias!

Anónimo dijo...

DOCTOR MENDEL ......he leido tu post en el blog de Elvira y solo por eso ,por habernoslo explicado tan bien te mereces un diez y un saludo !!

Anónimo dijo...

Está muy bien recrearse con la Genética. Gracias por estas ideas tan claras.
Por favor, mas cosillas para ayudar a iniciar a Mendelitos!!.
De nuevo, gracias.

giovanna dijo...

Muy bueno realmente tu aporte.